MALAT1

Species: Homo sapiens

Position: chr11: 65497687-65506516

Known as: MALAT1 , ENSG00000251562

Transcript: NR_002819 , NR_144567 , NR_144568 , ENST00000534336 , ENST00000619449

Sequence: Download

Description:

MALAT1 (metastasis associated lung adenocarcinoma transcript 1) is upregulated in many cancers, such as breast, pancreatic, lung, colon, prostate and liver cancer, and could inhibit tumor cell apoptosis and promote cell invasion in bladder cancer. Using "CRISPR Activation" (CRISPRa) and "CRISPR Interference" (CRISPRi) to up- and down-regulate MALAT1 expression, a reciprocal repression feedback loop between miR-125b and MALAT1 was found. Besides, due to the high expression in a variety of cell lines, MALAT1 is frequently used as representative lncRNA to develop CRISPR-cas9 techniques, like Crispr/Cas9-based HDR-mediated biallelic integration of poly(A), paired gRNA-guided CRISPR/Cas9 knockout (paired-KO) method, Double Excision CRISPR Knockout (DECKO), etc.



sgRNAs

sgRNA_ID Sequence Position (Chr) Position (Lnc) Length PAM Type Validity Cell line Note Ref.
sgRNA1 GCTGCGTCAGGGACAAACGC 65497676-65497695(-) gene body (near 5') 20 CGG CRISPRa Experimental validated T24 NA [1]
sgRNA2 GGAGGGACTGCGCAACCGGT 65497699-65497718(-) gene body (near 5') 20 GGG CRISPRa High activity T24 significant increases in MALAT1 expression [1]
sgRNA3 GGCGCTGCGCTTAAGAGGGC 65497796-65497815(-) gene body (near 5') 20 AGG CRISPRi Experimental validated T24 NA [1]
sgRNA4 GGGCTTCTGCGTTGCTAAAA 65497817-65497836(-) gene body (near 5') 20 TGG CRISPRi High activity T24;K562 yielded >85% knockdown [1] [2]
sgRNA5 GGCAGGAGAGGCCAGTTGCG 65497779-65497798(-) gene body (near 5') 20 GGG CRISPRi;CRISPRko High activity T24;Hela;HEK293T;IMR90;HCT116 highest repression observed,paried with sgRNA7 [1] [3]
sgRNA6 GCAACGCAGAAGCCCGGCGC 65497822-65497841(+) gene body (near 5') 20 CGG CRISPRki Experimental validated HEK293 NA [4]
sgRNA7 CGTGTAGCTATCAAGGGCCA 65497234-65497253(-) up stream 20 TGG CRISPRko High activity U937;HEK293;Hela;HEK293T;IMR90;HCT116 paried with sgRNA5,8 [5] [3]
sgRNA8 CCTACCGCACAGCTCGGGCG 65499028-65499047(-) gene body (near 5') 20 AGG CRISPRko Experimental validated U937;HEK293 paried with sgRNA7 [5]
sgRNA9 CAGCTGTTCTCAATTGACGC 65496729-65496748(-) up stream 20 TGG CRISPRko Experimental validated hPSCs paried with sgRNA10 [6]
sgRNA10 AAAATGGCGCTGCGCTTAAG 65497801-65497820(-) gene body (near 5') 20 AGG CRISPRi;CRISPRko High activity hPSCs;Hela successfully yielded biallelic deletions with high efficiency,paried with sgRNA9,11,12,13,14 [6] [7]
sgRNA11 GACAAAGCCATTCGCTTAGT 65498201-65498220(+) gene body (near 5') 20 TGG CRISPRko High activity hPSCs successfully yielded biallelic deletions with high efficiency,paried with sgRNA10 [6]
sgRNA12 GCTGGGGCTCAGTTGCGTAA 65498615-65498634(+) gene body (near 5') 20 TGG CRISPRko High activity hPSCs;MDA-MB-231 successfully yielded biallelic deletions with high efficiency,paried with sgRNA10,17 [6] [3] [8]
sgRNA13 TTGGTAAAAATCCGTGAGGT 65500761-65500780(+) gene body (near 5') 20 CGG CRISPRko High activity hPSCs successfully yielded biallelic deletions with high efficiency,paried with sgRNA10 [6]
sgRNA14 TTCAAGTAGGGTACGGACTT 65506590-65506609(+) down stream 20 TGG CRISPRko Experimental validated hPSCs paried with sgRNA10 [6]
sgRNA15 CCAACTTCCATTTTCAGTCT 65497346-65497365(-) up stream 20 AGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA16 [3]
sgRNA16 GGAAGCCTCAGCTCGCCTGA 65497844-65497863(+) gene body (near 5') 20 AGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA15 [3]
sgRNA17 AGGTTTCTAAAACATGACGG 65499284-65499303(+) gene body (near 5') 20 AGG CRISPRko High activity Hela;HEK293T;IMR90;HCT116;MDA-MB-231 paried with sgRNA12 [3] [8]
sgRNA18 GTTGAGATGAAGCTTCTTCA 65499306-65499325(+) gene body (near 5') 20 TGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA19 [3]
sgRNA19 TCAACCGTCCCTGCAAGGCT 65498598-65498617(+) gene body (near 5') 20 GGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA18 [3]
sgRNA20 CAAACCTCGTGTAGCTATCA 65497241-65497260(-) up stream 20 AGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA21 [3]
sgRNA21 AATGTGAAGGACTTTCGTAA 65500266-65500285(+) gene body (near 5') 20 CGG CRISPRko Experimental validated Hela;HEK293T;IMR90;HCT116 paried with sgRNA20 [3]
sgRNA22 AAGGACTGGGGCCCCGCAAC 65497765-65497784(+) gene body (near 5') 20 TGG CRISPRi Experimental validated Hela NA [7]
sgRNA23 GCAGCCCGAGACTTCTGTAA 65497746-65497765(+) gene body (near 5') 20 AGG CRISPRi Experimental validated Hela NA [7]
sgRNA24 GCGCTGCGCTTAAGAGGGC 65497796-65497814(-) gene body (near 5') 19 AGG CRISPRi Experimental validated K562 NA [2]
sgRNA25 CCGCAGATCAGAGTGGGCCAC 65498358-65498378(+) gene body (near 5') 21 TGG CRISPRko Experimental validated Huh7.5 paried with sgRNA26 [9]
sgRNA26 GGATAGTACACTTCACTCAG 65503381-65503400(+) gene body (near 3') 20 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA25 [9]
sgRNA27 ACACAAGAAGTGCTTTAAG 65498714-65498732(+) gene body (near 5') 19 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA28 [9]
sgRNA28 GGGATCAAGTGGATTGAGG 65503062-65503080(+) gene body (near 3') 19 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA27 [9]
sgRNA29 CCCGAATTAATACCAATAGA 65499376-65499395(+) gene body (near 5') 20 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA30 [9]
sgRNA30 CTTGAATGTCTCTTAGAGGG 65502571-65502590(+) gene body (near 3') 20 TGG CRISPRko Experimental validated Huh7.5 paried with sgRNA29 [9]
sgRNA31 CCCATCAATTTAATTTCTGG 65500026-65500045(+) gene body (near 5') 20 TGG CRISPRko Experimental validated Huh7.5 paried with sgRNA32 [9]
sgRNA32 CCAGTTTGAATTGGGAAGCT 65502038-65502057(+) gene body (near 5') 20 GGG CRISPRko Experimental validated Huh7.5 paried with sgRNA31 [9]
sgRNA33 GAGCCAGTGCGATTTGGTGA 65500537-65500556(+) gene body (near 5') 20 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA34 [9]
sgRNA34 GGTCTTAACAGGGAAGAGAG 65501532-65501551(+) gene body (near 5') 20 AGG CRISPRko Experimental validated Huh7.5 paried with sgRNA33 [9]

GBrowser


Links

lncRNA Function:

sgRNA Design Tool:

Reference

1. Xie H, Liao X, Chen Z, Fang Y, He A, et al. (2017). LncRNA MALAT1 Inhibits Apoptosis and Promotes Invasion by Antagonizing miR-125b in Bladder Cancer Cells. J Cancer 8(18): 3803-3811.

2. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, et al. (2014). Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159(3): 647-61.

3. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigó R, et al. (2015). DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics 16: 846.

4. Liu Y, Han X, Yuan J, Geng T, Chen S, et al. (2017). Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes. J Biol Chem 292(14): 5624-5633.

5. Janga H, Aznaourova M, Boldt F, Damm K, Grünweller A, et al. (2018). Cas9-mediated excision of proximal DNaseI/H3K4me3 signatures confers robust silencing of microRNA and long non-coding RNA genes. PLoS One 13(2): e0193066.

6. Liu Z, Hui Y, Shi L, Chen Z, Xu X, et al. (2016). Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells. Stem Cell Reports 7(3): 496-507.

7. Stojic L, Lun ATL, Mangei J, Mascalchi P, Quarantotti V, et al. (2018). Specificity of RNAi, LNA and CRISPRi as loss-of-function methods in transcriptional analysis. Nucleic Acids Res.

8. Kim J, Piao HL, Kim BJ, Yao F, Han Z, et al. (2018). Long noncoding RNA MALAT1 suppresses breast cancer metastasis. Nat Genet 50(12): 1705-1715.

9. Zhu S, Li W, Liu J, Chen CH, Liao Q, et al. (2016). Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library. Nat Biotechnol 34(12): 1279-1286.