All
Gene Species Chrom sgRNA PAM Type Validity PMID
Haunt Mus musculus chr6 CTTTGAAAAGAAGTGAAGGA AGG CRISPRko High activity 26615201
Haunt Mus musculus chr6 GATGCATGCCTGGCTCTTCC TGG CRISPRki Experimental validated 25891907
Haunt Mus musculus chr6 GGCAGTGTGTACCGAGGCTT TGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GGCTAGAACTACATTTTTAC AGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GGAGACACGGCGCTATGCGA TGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GGAAGGGTGCAAAGGAAGGG TGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GGTTGTATCACCTCCGCCCA CGG CRISPRko;CRISPRki Experimental validated 25891907
Haunt Mus musculus chr6 GGACCGTCTCTCCAGATGCA AGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GCTATTTACAGTGAAGACAC TGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GCTTGAAATTGGGACAGGCA AGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GCTACTGTGAGTGCTCACTG CGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GTAGGAATGAAGAGAACATT AGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 GGTCACTTTTCAACCCCACA GGG CRISPRko Experimental validated 25891907
Haunt Mus musculus chr6 TTGTCTCCTCCAGAGTCACT TGG CRISPRki Experimental validated 25891907
Hottip Mus musculus chr6 CTCCGAGAGTCTCCGAGAAT TGG CRISPRko;CRISPRki Experimental validated 28384324
Hottip Mus musculus chr6 CTCGAGGGCAGTTTACATAC AGG CRISPRko Experimental validated 28384324
Hottip Mus musculus chr6 GGCCCACTTACTCAGTTTCC AGG CRISPRko Experimental validated 28384324
Hottip Mus musculus chr6 CACTCCCTCCCGCTTTGTAC AGG CRISPRko Experimental validated 28384324
Hottip Mus musculus chr6 GCAGTAAGAAGGTAAACTCG GGG CRISPRa Experimental validated 28384324
Hottip Mus musculus chr6 TCTCCTGACTTTAGCGGTCC TGG CRISPRa Experimental validated 28384324
Hottip Mus musculus chr6 TACCCAGGACCGCTAAAGTC AGG CRISPRa Experimental validated 28384324
Hottip Mus musculus chr6 GGATCAGGGAAGGTTTTATT GGG CRISPRa Experimental validated 28384324
Hottip Mus musculus chr6 GGGATCAGGGAAGGTTTTAT TGG CRISPRa Experimental validated 28384324
Hoxb3os Mus musculus chr11 AAGGTGATTCTGGGAGATCT AGG CRISPRko Experimental validated 29716997
Hoxb3os Mus musculus chr11 ACTGCTCTTAACTAGGCCAG CGG CRISPRko Experimental validated 29716997