All
Gene Species Chrom sgRNA PAM Type Validity PMID
PVT1 Homo sapiens chr8 GGACCGAGGACGCACGCGGC GGG CRISPRa Experimental validated 29731168
PVT1 Homo sapiens chr8 GCCGGGACCGAGGACGCACG CGG CRISPRa Experimental validated 29731168
PVT1 Homo sapiens chr8 GCCTGCTTCCCGGCAGCGC AGG CRISPRa Experimental validated 29731168
PVT1 Homo sapiens chr8 GGGCGACTGCGGCCGCCAA GGG CRISPRa Experimental validated 29731168
PVT1 Homo sapiens chr8 GCCGCCACACGCGCTCTGCC CGG CRISPRedit Experimental validated 29731168
SLC25A25-AS1 Homo sapiens chr9 GATGGAGAATGTAAGGGTAC AGG CRISPRi Experimental validated 29860520
SLC25A25-AS1 Homo sapiens chr9 TGCAGAGAACGGAGGCATGC AGG CRISPRi Experimental validated 29860520
SPRIGHTLY Homo sapiens chr5 GCTCCCTGCTTCCCCTGCA AGG CRISPRko Experimental validated 28508063
SPRIGHTLY Homo sapiens chr5 TCATGTTATCATTGTCCGG GGG CRISPRko Experimental validated 28508063
STOX2-IT3-lncRNA Homo sapiens chr4 TGCATGTGCGTTTGGTTCAC TGG CRISPRi Experimental validated 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 GACAGTAAACTCGGCTGTGA TGG CRISPRi Experimental validated 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 TAAACTCGGCTGTGATGGAA TGG CRISPRi Designed by expert 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 GGGAGAGAAGACAGTAAACT CGG CRISPRi Designed by expert 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 TGCATGTGTGCATGTGCGTT TGG CRISPRi Designed by expert 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 AAACGCACATGCACACATGC AGG CRISPRi Designed by expert 27555360
STOX2-IT3-lncRNA Homo sapiens chr4 AACGCACATGCACACATGCA GGG CRISPRi High activity 27555360
TERC Homo sapiens chr3 GTCTAACCCTAACTGAGAA GGG CRISPRi Experimental validated 25307932
TERC Homo sapiens chr3 GCCTACGCCCTTCTCAGTTA GGG CRISPRi Experimental validated 25307932
THOR Homo sapiens chr2 AGGGTGTAGCGCGGGCTAGA AGG CRISPRko High activity 29245011 , 29626476
THOR Homo sapiens chr2 GTAGGTGCTGCCATGCCAG GGG CRISPRko High activity 29245011 , 29626476
THOR Homo sapiens chr2 GTTCCAAGGTGCTTCTCTC TGG CRISPRko Experimental validated 29245011
THOR Homo sapiens chr2 TGAAATATTGATTTCTGTC TGG CRISPRko Experimental validated 29245011
THOR Homo sapiens chr2 TTCACACACCATAGAGAGG CGG CRISPRko Experimental validated 29245011
THOR Homo sapiens chr2 AGGGTGTAGCGCGGGCTAGA AGG CRISPRko Experimental validated 29752937
THOR Homo sapiens chr2 GTAGGTGCTGCCATGCCAG GGG CRISPRko Experimental validated 29752937