All
Gene Species Chrom sgRNA PAM Type Validity PMID
LINC-ROR Homo sapiens chr18 GACCCTGTTTTTAATTCGTT TGG CRISPRko Experimental validated 26656491
LIPE-AS1 Homo sapiens chr19 GCCTATCGCTGCCCGAGTT GGG CRISPRi Experimental validated 29059299
LIPE-AS1 Homo sapiens chr19 GGGCCTCTGCGGAGTGGACC AGG CRISPRi Experimental validated 29059299
LOC389641 Homo sapiens chr8 GAAGTTCAGGGTTAGCCAAC AGG CRISPRi Experimental validated 28180319
LOC389641 Homo sapiens chr8 GAATGCAGCGGCATCCACG CGG CRISPRi Experimental validated 28180319
LOC389641 Homo sapiens chr8 GACCGAGAAGCCTGGCGC TGG CRISPRi Experimental validated 28180319
LOC389641 Homo sapiens chr8 GGCGCTCGGTGGACGGAT GGG CRISPRi Experimental validated 28180319
LOC389641 Homo sapiens chr8 GGCAGGCTGAATCACTCGCC CGG CRISPRi Experimental validated 28180319
LOC646329 Homo sapiens chr7 GCTTAGGAAATCACCAGCTCC TGG CRISPRi Experimental validated 27081004
LOC646329 Homo sapiens chr7 GGTCTGCCGTGACAGTTCAGT AGG CRISPRi Experimental validated 27081004
MANTIS Homo sapiens chr2 CTTCATTTTGAGGGCTCGTC TGG CRISPRko Experimental validated 28351900
MANTIS Homo sapiens chr2 CTACCACTTGGCAACCCGCT CGG CRISPRko Experimental validated 28351900
MNX1-AS1 Homo sapiens chr7 GGGCGCACCTGTCACCGTCC CGG CRISPRi Experimental validated 28180319
MNX1-AS1 Homo sapiens chr7 GGAGTATCCACTCCCCGT TGG CRISPRi Experimental validated 28180319
MNX1-AS1 Homo sapiens chr7 GGTTGCCAGTGCCCGCCGTC CGG CRISPRi Experimental validated 28180319
NIPBL-AS1 Homo sapiens chr5 ATAGAGAACGGTGGAACAA TGG CRISPRi Experimental validated 29261648
NIPBL-AS1 Homo sapiens chr5 TCCAGGAAAATAAAGACAG AGG CRISPRi Experimental validated 29261648
NOP14-AS1 Homo sapiens chr4 GACGGACGGTCGCACAGACG CGG CRISPRa;CRISPRi High activity 29059299 , 28180319
NOP14-AS1 Homo sapiens chr4 GGTCGCACAGACGCGGAACA GGG CRISPRi Experimental validated 29059299
NOP14-AS1 Homo sapiens chr4 ACAGCCAAGCAGCGACCCGC AGG CRISPRa;CRISPRi High activity 29059299 , 28180319
NOP14-AS1 Homo sapiens chr4 GTCTCGGCCTCGGGGTTACG CGG CRISPRi Experimental validated 28180319
NOP14-AS1 Homo sapiens chr4 GCCCATGGGTCCGCTCCGCG GGG CRISPRi Experimental validated 28180319
NOP14-AS1 Homo sapiens chr4 AGAGATGTACGTCACTTCCG GGG CRISPRi;CRISPRko Experimental validated 28180319
NOP14-AS1 Homo sapiens chr4 AAGTAGGACAAGGCCAACTG TGG CRISPRko Experimental validated 28180319
PANDAR Homo sapiens chr6 CGTGCACACATTTAACCCGA AGG CRISPRko Experimental validated 29416011