All
Gene Species Chrom sgRNA PAM Type Validity PMID
HBL1 Homo sapiens chr13 TAGAGTAGTTCAATCAATAC TGG CRISPRko Experimental validated 28829943
HBL1 Homo sapiens chr13 ACTTTGAAATTAACTTGATT TGG CRISPRi Experimental validated 28829943
HBL1 Homo sapiens chr13 AATCCCCTGGGATGCAGGAA TGG CRISPRi Experimental validated 28829943
HOXD-AS1 Homo sapiens chr2 GGTCGCGACGGCTCTCCTC GGG CRISPRi Experimental validated 28180319
HOXD-AS1 Homo sapiens chr2 GCGAGGAGCGGCGCGCCGAC CGG CRISPRi Experimental validated 28180319
HOXD-AS1 Homo sapiens chr2 GTGGCGCTGGCCGGCCAA TGG CRISPRi Experimental validated 28180319
HypERlnc Homo sapiens chr16 CAAATATAGTCAGCGGATAG GGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 GCCAAATATAGTCAGCGGAT AGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 CAGGAGAATCGCCTACACCT GGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 GCAGGAGAATCGCCTACACC TGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 ATGTGCTTAGGTCTCGGGGT GGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 CTAGCCTCAGTCTTTCGATC TGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 TGAGCACTTCGCTGCCGTTA TGG CRISPRa Experimental validated 28611075
HypERlnc Homo sapiens chr16 CTTGAGGAACTAGACGTCTC AGG CRISPRa Experimental validated 28611075
LINC00173 Homo sapiens chr12 TCCCACCTGCTCTAAGCGCT TGG CRISPRko Experimental validated 28803142
LINC00173 Homo sapiens chr12 GCTCTAAGCGCTTGGTACCA GGG CRISPRko Experimental validated 28803142
LINC00173 Homo sapiens chr12 AGATCACGTGAACTGGTGAT GGG CRISPRko Experimental validated 28803142
LINC00173 Homo sapiens chr12 ACCATTTGGCTCCTATGCAC AGG CRISPRko Experimental validated 28803142
LINC00441 Homo sapiens chr13 GCTGGTCGGTGCGCGGGCT GGG CRISPRi Experimental validated 28180319
LINC00441 Homo sapiens chr13 GTTCCCCACAGACGCCGGC GGG CRISPRi Experimental validated 28180319
LINC00657 Homo sapiens chr20 TTCCGGTCCGGCAGAGATCG CGG CRISPRko Experimental validated 26942882
LINC00657 Homo sapiens chr20 ACTCTATTCTACAAGCAACG AGG CRISPRko Experimental validated 26942882
LINC01021 Homo sapiens chr5 AGGGGTCCCTAGAGAATTTC TGG CRISPRko Experimental validated 29262524
LINC01021 Homo sapiens chr5 GAGGAATTCATGCCTTGCAA AGG CRISPRko Experimental validated 29262524
LINC-ROR Homo sapiens chr18 GATGGCATTTCAGTTCTTCC AGG CRISPRko Experimental validated 26656491