All
Gene Species Chrom sgRNA PAM Type Validity PMID
MALAT1 Homo sapiens chr11 GGTCTTAACAGGGAAGAGAG AGG CRISPRko Experimental validated 27798563
roX1 Drosophila melanogaster chrX ATACAATAATATTAGCTAAC TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TAACATTAACAGCAATGTTT GGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX CTCGTTGGAAAAAGTTACTG TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TAGAACAATTACGTTCGGAG TGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX TACTATTACCGATCGATCAC TGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX TGTTAATTTGCCTTACCAAC TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX CGAAAAAACGAGGGCCATTA GGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX AAGAAAAGTGTTAGTTACC AGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TCGACAAGTGGCAGCCCTAA TGG CRISPRi High activity 26850642
roX2 Drosophila melanogaster chrX CTGCATGAATCCGAAAATAG CGG CRISPRi Experimental validated 26850642
roX2 Drosophila melanogaster chrX CCAAAACTCGAAAATATCAA GGG CRISPRi High activity 26850642
roX2 Drosophila melanogaster chrX GGCCTGGTCACACTAAGCTA GGG CRISPRi High activity 26850642
AK023948 Homo sapiens chr8 GAGTTTTAGTCACCTATCTA GGG CRISPRko High activity 25414344 , 28176758
AK023948 Homo sapiens chr8 GGTGATCCTTGTGCACGGCC AGG CRISPRko High activity 25414344 , 28176758
BC200 Homo sapiens chr2 ATAACCCTATGGCCAGCAGA GGG CRISPRko Experimental validated 27277684
BC200 Homo sapiens chr2 TTAAGAAGCTGAGGAAAGCA AGG CRISPRko Experimental validated 27277684
CASC9 Homo sapiens chr8 GCAGGATATAATCTCGTGGT GGG CRISPRi;CRISPRa High activity 29790588
CASC9 Homo sapiens chr8 GGCGTAGGACCCTCTGAACC AGG CRISPRi;CRISPRa High activity 29790588
CCAT2 Homo sapiens chr8 GAGCTAAGAGGAAACCACCT TGG CRISPRko Experimental validated 28964256
CCAT2 Homo sapiens chr8 CTCCTATTCATACCATATTA AGG CRISPRko Experimental validated 28964256
GAS5 Homo sapiens chr1 GCGCTCCAGCCTTTGTCTGCTA AGG CRISPRi Experimental validated 25307932
GAS5 Homo sapiens chr1 GTTTTATCTTTGCGAATGTTG CGG CRISPRi Experimental validated 25307932
GAS5 Homo sapiens chr1 GGTGACCTTAGCAGACAAAGGC TGG CRISPRi Experimental validated 25307932
HBL1 Homo sapiens chr13 CTAGCTTGAAGATGCCAAC AGG CRISPRko Experimental validated 28829943