All
Gene Species Chrom sgRNA PAM Type Validity PMID
HOTAIR Homo sapiens chr12 CAGACCGAGGGAGATAACGG GGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 CCAGCCCGCTGAGCGCTCAG CGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 ATCTGGCGAGAGCAGTCGGG AGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 AGTCGAGTCGTTGGGAGAGA GGG CRISPRko Partial validated 27798563
MALAT1 Homo sapiens chr11 GCTGCGTCAGGGACAAACGC CGG CRISPRa Experimental validated 29151968
MALAT1 Homo sapiens chr11 GGAGGGACTGCGCAACCGGT GGG CRISPRa High activity 29151968
MALAT1 Homo sapiens chr11 GGCGCTGCGCTTAAGAGGGC AGG CRISPRi Experimental validated 29151968
MALAT1 Homo sapiens chr11 GGGCTTCTGCGTTGCTAAAA TGG CRISPRi High activity 29151968 , 25307932
MALAT1 Homo sapiens chr11 GGCAGGAGAGGCCAGTTGCG GGG CRISPRi;CRISPRko High activity 29151968 , 26493208
MALAT1 Homo sapiens chr11 GCAACGCAGAAGCCCGGCGC CGG CRISPRki Experimental validated 28196870
MALAT1 Homo sapiens chr11 CGTGTAGCTATCAAGGGCCA TGG CRISPRko High activity 29451908 , 26493208
MALAT1 Homo sapiens chr11 CCTACCGCACAGCTCGGGCG AGG CRISPRko Experimental validated 29451908
MALAT1 Homo sapiens chr11 CAGCTGTTCTCAATTGACGC TGG CRISPRko Experimental validated 27594587
MALAT1 Homo sapiens chr11 AAAATGGCGCTGCGCTTAAG AGG CRISPRi;CRISPRko High activity 27594587 , 29860520
MALAT1 Homo sapiens chr11 GACAAAGCCATTCGCTTAGT TGG CRISPRko High activity 27594587
MALAT1 Homo sapiens chr11 GCTGGGGCTCAGTTGCGTAA TGG CRISPRko High activity 27594587 , 26493208
MALAT1 Homo sapiens chr11 TTGGTAAAAATCCGTGAGGT CGG CRISPRko High activity 27594587
MALAT1 Homo sapiens chr11 TTCAAGTAGGGTACGGACTT TGG CRISPRko Experimental validated 27594587
MALAT1 Homo sapiens chr11 CCAACTTCCATTTTCAGTCT AGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 GGAAGCCTCAGCTCGCCTGA AGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 AGGTTTCTAAAACATGACGG AGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 GTTGAGATGAAGCTTCTTCA TGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 TCAACCGTCCCTGCAAGGCT GGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 CAAACCTCGTGTAGCTATCA AGG CRISPRko Experimental validated 26493208
MALAT1 Homo sapiens chr11 AATGTGAAGGACTTTCGTAA CGG CRISPRko Experimental validated 26493208