All
Gene Species Chrom sgRNA PAM Type Validity PMID
Rian Mus musculus chr12 GGCCAGCAATCATGTCTCAG TGG CRISPRko Experimental validated 25137067
Rian Mus musculus chr12 GGCAAGGTTAGGATTATACAA TGG CRISPRko Experimental validated 25137067
Spaar Mus musculus chr4 GGAGACCGCGGTGATTGGGA TGG CRISPRko Experimental validated 28024296
Spaar Mus musculus chr4 CTTGTCACACCGAACACGGT GGG CRISPRko Experimental validated 28024296
Trdn-AS Mus musculus chr10 GTGACATTCATGTGGCAGTG TGG CRISPRa Experimental validated 29126880
Tsix Mus musculus chrX ACAGTGGCAAAGTGCTTTCA GGA CRISPRedit Experimental validated 29237010
Tslrn1 Mus musculus chrX TATATTTCTTGGTGGCACAC AGG CRISPRko Experimental validated 29044429
Tslrn1 Mus musculus chrX TGACACTGTATCCTTTCATC TGG CRISPRko Experimental validated 29044429
Xist Mus musculus chrX CATACGTAGTTCCCCGCTCT TGG CRISPRedit Experimental validated 29237010
ROSA26 Oryctolagus cuniculus chrUn0104 GGAGCATGCAGCTTTTTCTT GGG CRISPRki High activity 27117226
Rffl-lnc1 Rattus norvegicus chr10 AAGCCATGGAGTTAGGCCAT AGG CRISPRki High activity 28827789
lncRNA1459 Solanum lycopersicum chr3 GCCTTGCAACTCCTGTCGAA TGG CRISPRko Experimental validated 29446503
XIST Sus scrofa chrX GGATCCCATCCCTCCTAC TGG CRISPRko Experimental validated 28034840
XIST Sus scrofa chrX GAATGTTTTTTGGTTGACTCTTC TGG CRISPRko Experimental validated 28034840
XIST Sus scrofa chrX GGCTATTATTCATCTTAACC AGG CRISPRko High activity 28034840
XIST Sus scrofa chrX GGTATAGCCAAAACAGGAA TGG CRISPRko High activity 28034840
XIST Sus scrofa chrX GGAAAAGTGTTGGGTTTTG TGG CRISPRko Experimental validated 28034840
NEAT1 Homo sapiens chr11 TTTGGGAGGCGAATGCCATG AGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 AGCACTGTTAAAGAGAAGCG GGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 AGTCTCTCCGGGCAGGGTCG GGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 CTGGGAGACCATGCACCGCC CGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 AGAGACTCCCGGGCGGTGCA TGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 GCACCGCCCGGGAGTCTCTC CGG CRISPRa High activity 30180948
NEAT1 Homo sapiens chr11 GGCTATAAAAGCAAAAGTTG TGG CRISPRko Experimental validated 28325845
NEAT1 Homo sapiens chr11 GTCCAGCCGGAGTTAGCGAC AGG CRISPRko Experimental validated 28325845