All
Gene Species Chrom sgRNA PAM Type Validity PMID
HoxBlinc Mus musculus chr11 TTGCTATGCTCAACGCGCTT GGG CRISPRko Experimental validated 26725110
HoxBlinc Mus musculus chr11 ATGCGCCACCGAAAGTCGCG CGG CRISPRko Experimental validated 26725110
Linc-cox2 Mus musculus chr1 TCTTTGATGCAAGGAACTAC AGG CRISPRko Experimental validated 29051223
Linc-cox2 Mus musculus chr1 TTACACTGTTTATCGCTGGT TGG CRISPRko Experimental validated 29051223
Linc-cox2 Mus musculus chr1 ATCATTAACCTGTTATCATA TGG CRISPRko Experimental validated 29051223
Linc-cox2 Mus musculus chr1 CTTCAATAGACATATCTTTA GGG CRISPRko Experimental validated 29051223
lncCSR Mus musculus chr12 AGGCAGGTGAGGATAATTCC TGG CRISPRko Experimental validated 25957685
lncCSR Mus musculus chr12 CGGACCCAAGCTTAGACGCT TGG CRISPRko Experimental validated 25957685
LncHand2 Mus musculus chr8 ATACTGAAGAATCTTAAACC AGG CRISPRko Experimental validated 29653123
LncHand2 Mus musculus chr8 ACGACATATATTAACCCGAG CGG CRISPRko Experimental validated 29653123
LncHand2 Mus musculus chr8 AAGCAGGTTTAGTTATCGGA GGG CRISPRko Experimental validated 29653123
LncHand2 Mus musculus chr8 TGGTGGCGACAAGAGTCTGG AGG CRISPRko Experimental validated 29653123
LncHand2 Mus musculus chr8 CCATGTTGTACTGATTCAGT GGG CRISPRki Experimental validated 29653123
LncKdm2b Mus musculus chr5 GGTCAAAACTTGTATAAGAT TGG CRISPRko Experimental validated 29535137
LncKdm2b Mus musculus chr5 GACCGGATCTCTCCTATCAA AGG CRISPRko Experimental validated 29535137
LncKdm2b Mus musculus chr5 TATCACCTGATGCAGACCTG AGG CRISPRko Experimental validated 28319097
LncKdm2b Mus musculus chr5 GGAATCAGCTGACCTGGCTG AGG CRISPRko Experimental validated 28319097
LncKdm2b Mus musculus chr5 CTTAGTCTCTGAGTTAGATG TGG CRISPRko Experimental validated 28319097
Peat Mus musculus chr2 ACTTTAGCTACTCTTTGAGC TGG CRISPRko High activity 27986952
Peat Mus musculus chr2 TGTAAGGACAGACTACGCAA CGG CRISPRko High activity 27986952
Playrr Mus musculus chr3 TAGACGCAGCTGTGCTTAGA AGG CRISPRedit Experimental validated 26411685
Playrr Mus musculus chr3 GTGGCGGACTCATGTTAAAA AGG CRISPRko Experimental validated 26411685
Playrr Mus musculus chr3 GTGATTCCCACCACGCTTTG AGG CRISPRko Experimental validated 26411685
Rian Mus musculus chr12 GGCCTTCAGTGAACCATGGA TGG CRISPRko Experimental validated 25137067
Rian Mus musculus chr12 GGAAGTTGTTGTTAAACAGT GGG CRISPRko Experimental validated 25137067