All
Gene Species Chrom sgRNA PAM Type Validity PMID
thor Danio rerio chr1 CGATTGCACTGGTTGAGAAA AGG CRISPRko Experimental validated 29245011
thor Danio rerio chr1 GGTCACCTTTTTGGTCGTGA TGG CRISPRko Experimental validated 29245011
H19 Homo sapiens chr11 GGGGGGTAACGGGGGAAACT GGG CRISPRi High activity 25307932
H19 Homo sapiens chr11 GCTAGGACCGAGGAGCAGGGTG AGG CRISPRi High activity 29860520 , 25307932
21A Homo sapiens chr8 TATTTCTTCCATCACCATAA AGG CRISPRko High activity 25414344
21A Homo sapiens chr8 AAGTGTTTGAATTAGCAGGT GGG CRISPRko High activity 25414344
roX1 Drosophila melanogaster chrX ATACAATAATATTAGCTAAC TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TAACATTAACAGCAATGTTT GGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX CTCGTTGGAAAAAGTTACTG TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TAGAACAATTACGTTCGGAG TGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX TACTATTACCGATCGATCAC TGG CRISPRi Experimental validated 26850642
roX1 Drosophila melanogaster chrX TGTTAATTTGCCTTACCAAC TGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX CGAAAAAACGAGGGCCATTA GGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX AAGAAAAGTGTTAGTTACC AGG CRISPRi High activity 26850642
roX1 Drosophila melanogaster chrX TCGACAAGTGGCAGCCCTAA TGG CRISPRi High activity 26850642
roX2 Drosophila melanogaster chrX CTGCATGAATCCGAAAATAG CGG CRISPRi Experimental validated 26850642
roX2 Drosophila melanogaster chrX CCAAAACTCGAAAATATCAA GGG CRISPRi High activity 26850642
roX2 Drosophila melanogaster chrX GGCCTGGTCACACTAAGCTA GGG CRISPRi High activity 26850642
HOTAIR Homo sapiens chr12 GGGCCGCCCTCCTAGTGGTT CGG CRISPRi Experimental validated 28180319
HOTAIR Homo sapiens chr12 GAGGGGACGCACGTGTACC TGG CRISPRi Experimental validated 28180319
HOTAIR Homo sapiens chr12 GCGGCTCTCGCCTGAGAAC TGG CRISPRi Experimental validated 28180319
HOTAIR Homo sapiens chr12 ACCGAGGGAGATAACGGGGG AGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 GAGGGGGCAAGTGCGAGGAG AGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 CTGGCGCCCCGGGAAGCCCG CGG CRISPRko Partial validated 27798563
HOTAIR Homo sapiens chr12 GACCCCCGCCTGGAACGCAG TGG CRISPRko Partial validated 27798563